UNK_ZnF1-3_pGEX
(Plasmid
#219664)
-
PurposeRecombinant expression of UNK ZnF1-3 with dual-affinity tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-6P-1
- Backbone size w/o insert (bp) 5084
- Total vector size (bp) 5516
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUnkempt Zinc Fingers 1-3
-
Alt nameUNK ZnF1-3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)432
-
GenBank ID
-
Tags
/ Fusion Proteins
- GST (N terminal on insert)
- SBP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.29.577729 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UNK_ZnF1-3_pGEX was a gift from Daniel Dominguez (Addgene plasmid # 219664 ; http://n2t.net/addgene:219664 ; RRID:Addgene_219664) -
For your References section:
Understanding species-specific and conserved RNA-protein interactions in vivo and in vitro. Harris SE, Alexis MS, Giri G, Cavazos FF Jr, Hu Y, Murn J, Aleman MM, Burge CB, Dominguez D. Nat Commun. 2024 Sep 27;15(1):8400. doi: 10.1038/s41467-024-52231-7. 10.1038/s41467-024-52231-7 PubMed 39333159