Skip to main content

UNK_ZnF4-6_pGEX
(Plasmid #219665)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219665 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX-6P-1
  • Backbone size w/o insert (bp) 5084
  • Total vector size (bp) 5480
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Unkempt Zinc Fingers 4-6
  • Alt name
    UNK ZnF4-6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    396
  • Tags / Fusion Proteins
    • GST (N terminal on insert)
    • SBP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.01.29.577729 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UNK_ZnF4-6_pGEX was a gift from Daniel Dominguez (Addgene plasmid # 219665 ; http://n2t.net/addgene:219665 ; RRID:Addgene_219665)
  • For your References section:

    Understanding species-specific and conserved RNA-protein interactions in vivo and in vitro. Harris SE, Alexis MS, Giri G, Cavazos FF Jr, Hu Y, Murn J, Aleman MM, Burge CB, Dominguez D. Nat Commun. 2024 Sep 27;15(1):8400. doi: 10.1038/s41467-024-52231-7. 10.1038/s41467-024-52231-7 PubMed 39333159