Skip to main content

pJP_Ctrl10
(Plasmid #219672)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219672 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJP_Ctrl05.2
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 6295

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Promoter PT3lacO

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTGTTATCGCTACCCTGTC
  • 3′ sequencing primer CAACGTTCAAATCCGCTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    lacI
  • Promoter pR

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcatggcaattctggaag
  • 3′ sequencing primer GTCAGAAGTATTGGTAATCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.03.28.586779 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJP_Ctrl10 was a gift from Yolanda Schaerli (Addgene plasmid # 219672 ; http://n2t.net/addgene:219672 ; RRID:Addgene_219672)
  • For your References section:

    From resonance to chaos by modulating spatiotemporal patterns through a synthetic optogenetic oscillator. Park JH, Hollo G, Schaerli Y. Nat Commun. 2024 Aug 23;15(1):7284. doi: 10.1038/s41467-024-51626-w. 10.1038/s41467-024-51626-w PubMed 39179558