CMV-d2eGFP-20pf
              
              
                (Plasmid
                
                #21971)
              
            
            
            
          - 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepcDNA5
- Backbone size w/o insert (bp) 5000
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameCMV d2eGFP miR-20 perfect
- 
                  Insert Size (bp)50
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
From Supplementary Table 1: "miR-20 perfect CMV sponge and U6 sponge, 2 sites:
CUACCUGCACUAUAAGCACUUUA"
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: CMV-d2eGFP-20pf was a gift from Phil Sharp (Addgene plasmid # 21971 ; http://n2t.net/addgene:21971 ; RRID:Addgene_21971)
- 
                For your References section: MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert MS, Neilson JR, Sharp PA. Nat Methods. 2007 Sep . 4(9):721-6. 10.1038/nmeth1079 PubMed 17694064