pD2sE_SC14
(Plasmid
#219717)
-
PurposeDV2 stable E dimer
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePalphaH
-
Backbone manufacturermodified from pHLSec
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDV2 sE SC14
-
SpeciesDengue virus
-
Insert Size (bp)1278
-
MutationA259W, T262R, F279W, T280P
-
Tags
/ Fusion Proteins
- human serum albumin (HSA) (N terminal on insert)
- 8xHis (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAAA
- 3′ sequencing primer ACACCAGCCACCACCTTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD2sE_SC14 was a gift from Brian Kuhlman (Addgene plasmid # 219717 ; http://n2t.net/addgene:219717 ; RRID:Addgene_219717) -
For your References section:
Designed, highly expressing, thermostable dengue virus 2 envelope protein dimers elicit quaternary epitope antibodies. Kudlacek ST, Metz S, Thiono D, Payne AM, Phan TTN, Tian S, Forsberg LJ, Maguire J, Seim I, Zhang S, Tripathy A, Harrison J, Nicely NI, Soman S, McCracken MK, Gromowski GD, Jarman RG, Premkumar L, de Silva AM, Kuhlman B. Sci Adv. 2021 Oct 15;7(42):eabg4084. doi: 10.1126/sciadv.abg4084. Epub 2021 Oct 15. 10.1126/sciadv.abg4084 PubMed 34652943