pD2sE_SC12
(Plasmid
#219719)
-
PurposeDV2 stable E dimer with fusion loop mutation and increased expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePalphaH
-
Backbone manufacturermodified from pHLSec
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDV2 sE SC12
-
SpeciesDengue virus
-
Insert Size (bp)1278
-
MutationG106D, A259W, T262R, F279W, T280P, S29K, T33V, A25M
-
Tags
/ Fusion Proteins
- human serum albumin (HSA) (N terminal on insert)
- 8xHis (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAAA
- 3′ sequencing primer ACACCAGCCACCACCTTCT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD2sE_SC12 was a gift from Brian Kuhlman (Addgene plasmid # 219719 ; http://n2t.net/addgene:219719 ; RRID:Addgene_219719) -
For your References section:
A conserved set of mutations for stabilizing soluble envelope protein dimers from dengue and Zika viruses to advance the development of subunit vaccines. Phan TTN, Hvasta MG, Kudlacek ST, Thiono DJ, Tripathy A, Nicely NI, de Silva AM, Kuhlman B. J Biol Chem. 2022 Jul;298(7):102079. doi: 10.1016/j.jbc.2022.102079. Epub 2022 May 26. 10.1016/j.jbc.2022.102079 PubMed 35643320