pD2rsE_RS1
              
              
                (Plasmid
                
                #219723)
              
            
            
            
          - 
            PurposeDV2 resurfaced E dimer to display 2D22/EDE region
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonePalphaH
 - 
              Backbone manufacturermodified from pHLSec
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameDV2 sE RS1
 - 
                    SpeciesDengue virus
 - 
                  Insert Size (bp)1278
 - 
                  MutationK51R, Q52N, A54Q, K64E, T76D, N83S, L107K, G106D, T120D, E136T, T138Y, E161Y, K163R, Q167N, I170T, E172D, E174D, T176D, T182Q, Q200E, N203T, T226N, A259W, T262R, S274N, F279W, T280P, K291N, S298N, K305T, D329N, T359Y, V382T, P384K
 - 
    
        Tags
        / Fusion Proteins
    
- human serum albumin (HSA) (N terminal on insert)
 - 8xHis (C terminal on insert)
 
 
Cloning Information
- Cloning method Gene Synthesis
 - 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAAA
 - 3′ sequencing primer ACACCAGCCACCACCTTCT (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pD2rsE_RS1 was a gift from Brian Kuhlman (Addgene plasmid # 219723 ; http://n2t.net/addgene:219723 ; RRID:Addgene_219723)