Skip to main content

pNK887
(Plasmid #219728)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219728 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Level 0 - promoter -like
  • Backbone size w/o insert (bp) 2251
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    promoter MinSyn110
  • Species
    Synthetic
  • Insert Size (bp)
    285
  • Promoter MinSyn110

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer gagcgaggaagcggaagagcgccc
  • 3′ sequencing primer accattattatcatgacattaacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNK887 was a gift from Alexander Mishin (Addgene plasmid # 219728 ; http://n2t.net/addgene:219728 ; RRID:Addgene_219728)
  • For your References section:

    Systematic Comparison of Plant Promoters in Nicotiana spp. Expression Systems. Shakhova ES, Markina NM, Mitiouchkina T, Bugaeva EN, Karataeva TA, Palkina KA, Fakhranurova LI, Yampolsky IV, Sarkisyan KS, Mishin AS. Int J Mol Sci. 2022 Dec 6;23(23):15441. doi: 10.3390/ijms232315441. 10.3390/ijms232315441 PubMed 36499768