pNK6030
(Plasmid
#219732)
-
PurposeMoClo-compatible Level 0 - promoter vector carrying promoter MinSyn1637x
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLevel 0 - promoter -like
- Backbone size w/o insert (bp) 2251
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepromoter MinSyn1637x
-
SpeciesSynthetic
-
Insert Size (bp)283
- Promoter MinSyn1637x
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer gagcgaggaagcggaagagcgccc
- 3′ sequencing primer accattattatcatgacattaacc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNK6030 was a gift from Alexander Mishin (Addgene plasmid # 219732 ; http://n2t.net/addgene:219732 ; RRID:Addgene_219732) -
For your References section:
Systematic Comparison of Plant Promoters in Nicotiana spp. Expression Systems. Shakhova ES, Markina NM, Mitiouchkina T, Bugaeva EN, Karataeva TA, Palkina KA, Fakhranurova LI, Yampolsky IV, Sarkisyan KS, Mishin AS. Int J Mol Sci. 2022 Dec 6;23(23):15441. doi: 10.3390/ijms232315441. 10.3390/ijms232315441 PubMed 36499768