pNK4169
(Plasmid
#219744)
-
PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 codon-optimised for expression in Pichia pastoris
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLevel 0-like
- Backbone size w/o insert (bp) 2247
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemutant of fungal hispidin-3-hydroxylase
-
Alt namennH3H_v2
-
SpeciesNeonothopanus nambi
-
Insert Size (bp)1266
-
MutationD37E, V181I, S323M, M385K
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer gagcgaggaagcggaagagcgccc
- 3′ sequencing primer accattattatcatgacattaacc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNK4169 was a gift from Alexander Mishin (Addgene plasmid # 219744 ; http://n2t.net/addgene:219744 ; RRID:Addgene_219744) -
For your References section:
An improved pathway for autonomous bioluminescence imaging in eukaryotes. Shakhova ES, Karataeva TA, Markina NM, Mitiouchkina T, Palkina KA, Perfilov MM, Wood MG, Hoang TT, Hall MP, Fakhranurova LI, Alekberova AE, Malyshevskaia AK, Gorbachev DA, Bugaeva EN, Pletneva LK, Babenko VV, Boldyreva DI, Gorokhovatsky AY, Balakireva AV, Gao F, Choob VV, Encell LP, Wood KV, Yampolsky IV, Sarkisyan KS, Mishin AS. Nat Methods. 2024 Mar;21(3):406-410. doi: 10.1038/s41592-023-02152-y. Epub 2024 Jan 22. 10.1038/s41592-023-02152-y PubMed 38253843