Skip to main content

M6570
(Plasmid #219773)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219773 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MoClo Level 0
  • Backbone size w/o insert (bp) 2247
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Promoter ORCA3
  • Species
    Synthetic
  • Insert Size (bp)
    830
  • Promoter pORCA3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer cttttgctggccttttgctc
  • 3′ sequencing primer ggttaatgtcatgataataatggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.02.17.636591 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    M6570 was a gift from Karen Sarkisyan (Addgene plasmid # 219773 ; http://n2t.net/addgene:219773 ; RRID:Addgene_219773)
  • For your References section:

    Non-invasive imaging of salicylic and jasmonic acid activities in planta. Balakireva AV, Karataeva TA, Karampelias M, Mitiouchkina TY, Macháček J, Shakhova ES, Perfilov MM, Belozerova OA, Palkina KA, Drazna N, Vondrakova Z, Fleiss A, Fakhranurova LI, Markina NM, Morozov VV, Bugaeva EN, Delnova GM, Choob VV, Yampolsky IV, Petrášek J, Mishin AS, Sarkisyan KS. bioRxiv 2025.02.17.636591; doi: https://doi.org/10.1101/2025.02.17.636591 10.1101/2025.02.17.636591