M7691
(Plasmid
#219775)
-
PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of WRKY70 promoter and terminator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219775 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMoClo Level M
- Backbone size w/o insert (bp) 4635
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepNOS-HygR-ocsT | pWRKY70-nnLuz-WRKY70_T
-
SpeciesSynthetic
-
Insert Size (bp)5708
- Promoter pNOS-HygR-ocsT | pWRKY70-nnLuz-WRKY70_T
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TTAGACAACTTAATAACACATTG
- 3′ sequencing primer AAACCTTTTCACGCCCTTTTAAATATC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.17.636591 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
M7691 was a gift from Karen Sarkisyan (Addgene plasmid # 219775 ; http://n2t.net/addgene:219775 ; RRID:Addgene_219775) -
For your References section:
Non-invasive imaging of salicylic and jasmonic acid activities in planta. Balakireva AV, Karataeva TA, Karampelias M, Mitiouchkina TY, Macháček J, Shakhova ES, Perfilov MM, Belozerova OA, Palkina KA, Drazna N, Vondrakova Z, Fleiss A, Fakhranurova LI, Markina NM, Morozov VV, Bugaeva EN, Delnova GM, Choob VV, Yampolsky IV, Petrášek J, Mishin AS, Sarkisyan KS. bioRxiv 2025.02.17.636591; doi: https://doi.org/10.1101/2025.02.17.636591 10.1101/2025.02.17.636591