pAAV-CMV-CD4-sTb(C)-M13-GFP
(Plasmid
#219780)
-
PurposesTb(C) half CaST for HEK cell expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219780 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCD4-sTb(C)-M13-GFP
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- HA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgactcactatagggagaccc
- 3′ sequencing primer GATCAGCGAGCTCTAGctcgag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.09.06.556431v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-CD4-sTb(C)-M13-GFP was a gift from Christina Kim (Addgene plasmid # 219780 ; http://n2t.net/addgene:219780 ; RRID:Addgene_219780) -
For your References section:
Rapid, biochemical tagging of cellular activity history in vivo. Zhang R, Anguiano M, Aarrestad IK, Lin S, Chandra J, Vadde SS, Olson DE, Kim CK. Nat Methods. 2024 Sep;21(9):1725-1735. doi: 10.1038/s41592-024-02375-7. Epub 2024 Aug 5. 10.1038/s41592-024-02375-7 PubMed 39103446