Skip to main content
Addgene
Open Menu

pCAV035_mCherry_P2A_fsEGFP_GGsite
(Plasmid #219807)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219807 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 3435
  • Total vector size (bp) 4923
  • Modifications to backbone
    The EGFP portion of this plasmid is frameshifted, which makes it non-fluorescent, but contains a golden gate site for BsaI recognition. Once digested with BsaI, an OG-A lesion can be ligated in at codon 34 of EGFP making it an assay for MUTYH-specific activity.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • GenBank ID
    AY678264.1
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer agctactaacttcagcctgctgaagc
  • 3′ sequencing primer caggaaacagctatgac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAV035_mCherry_P2A_fsEGFP_GGsite was a gift from Alexis Komor (Addgene plasmid # 219807 ; http://n2t.net/addgene:219807 ; RRID:Addgene_219807)

  • For your References section:

    Precision genome editing and in-cell measurements of oxidative DNA damage repair enable functional and mechanistic characterization of cancer-associated MUTYH variants. Vasquez CA, Osgood NRB, Zepeda MU, Sandel DK, Cowan QT, Peiris MN, Donoghue DJ, Komor AC. Nucleic Acids Res. 2025 Mar 20;53(6):gkaf037. doi: 10.1093/nar/gkaf037. 10.1093/nar/gkaf037 PubMed 40156857
Related items: