pCfb13196
(Plasmid
#219871)
-
PurposeThe base plasmid of TUNEYALI forTF06
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneOur own backbone
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameContains gRNA targeting TF06 (YALI1_D34785g) and homologous arm matching TF06
-
gRNA/shRNA sequenceACAATGAAATCGCACGACGT
-
SpeciesYarrowia lipolytica
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains gRNA targeting TF06 (YALI1_D34785g) and homologous arm matching TF06, which can be used for library construction by inserting promoters using a golden gate or directly knocking TF06 out.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCfb13196 was a gift from Irina Borodina (Addgene plasmid # 219871 ; http://n2t.net/addgene:219871 ; RRID:Addgene_219871)