Skip to main content

pCfb13201
(Plasmid #219876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219876 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Our own backbone
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Contains gRNA targeting TF11 (YALI1_E11341g) and homologous arm matching TF11
  • gRNA/shRNA sequence
    TTTTGGCACAGCAATATGCA
  • Species
    Yarrowia lipolytica

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains gRNA targeting TF11 (YALI1_E11341g) and homologous arm matching TF11, which can be used for library construction by inserting promoters using a golden gate or directly knocking TF11 out.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCfb13201 was a gift from Irina Borodina (Addgene plasmid # 219876 ; http://n2t.net/addgene:219876 ; RRID:Addgene_219876)
  • For your References section:

    High-throughput metabolic engineering of Yarrowia lipolytica through gene expression tuning. Jiang W, Wang S, Ahlheit D, Fumagalli T, Yang Z, Ramanathan S, Jiang X, Weber T, Dahlin J, Borodina I. Proc Natl Acad Sci U S A. 2025 Jun 10;122(23):e2426686122. doi: 10.1073/pnas.2426686122. Epub 2025 Jun 3. 10.1073/pnas.2426686122 PubMed 40460129