hKCNQ1 pCDNA3.1(-)
(Plasmid
#219953)
-
PurposeExpresses human KCNQ1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219953 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1(-)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5386
- Total vector size (bp) 7445
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKCNQ1
-
Alt nameKv7.1
-
Alt nameKvLQT1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2059
-
Mutationcontains silent sequence variations
-
GenBank IDNM_000218.3
-
Entrez GeneKCNQ1 (a.k.a. ATFB1, ATFB3, JLNS1, KCNA8, KCNA9, KVLQT1, Kv1.9, Kv7.1, LQT, LQT1, RWS, SQT2, WRS)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hKCNQ1 pCDNA3.1(-) was a gift from Niels Decher (Addgene plasmid # 219953 ; http://n2t.net/addgene:219953 ; RRID:Addgene_219953) -
For your References section:
KCNQ1 is an essential mediator of the sex-dependent perception of moderate cold temperatures. Kiper AK, Wegner S, Kadala A, Rinne S, Schutte S, Winter Z, Bertoune MAR, Touska F, Matschke V, Wrobel E, Streit AK, Lang F, Schmidt C, Schulze-Bahr E, Schafer MK, Voelkl J, Seebohm G, Zimmermann K, Decher N. Proc Natl Acad Sci U S A. 2024 Jun 18;121(25):e2322475121. doi: 10.1073/pnas.2322475121. Epub 2024 Jun 10. 10.1073/pnas.2322475121 PubMed 38857404