pSN993
(Plasmid
#219961)
-
PurposeExpresses CMT2A mutant version of human KIF1Bß in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbone∆pSM
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameunc-104 promoter::human KIF1Bß(Q98L)
-
SpeciesH. sapiens (human), C. elegans (nematode)
-
Entrez GeneKIF1B (a.k.a. CMT2, CMT2A, CMT2A1, HMSNII, KLP, NBLST1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGCCTGAGCCAACATTTTCTAATCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSN993 was a gift from Shinsuke Niwa (Addgene plasmid # 219961 ; http://n2t.net/addgene:219961 ; RRID:Addgene_219961)