pAAV-EFS-TadA8e-Sauri-U6-Camk2d sgRNA1
(Plasmid
#220117)
-
PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Camk2d start codon site by U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV-EFS-SauriABE8e-bGH-U6-sgRNA-BsmBI
-
Backbone manufactureraddgene
- Total vector size (bp) 7898
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTadA8e, nSauriCas9
-
gRNA/shRNA sequencetggtcgaagccATggcggggt
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgatgtcgtgtactggctc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EFS-TadA8e-Sauri-U6-Camk2d sgRNA1 was a gift from Yuxuan Guo (Addgene plasmid # 220117 ; http://n2t.net/addgene:220117 ; RRID:Addgene_220117) -
For your References section:
ABE-Mediated Cardiac Gene Silencing via Single AAVs Requires DNA Accessibility. Liu Z, Yang L, Yang Y, Li J, Chen Z, Guo C, Guo Q, Li Q, Zhao D, Hu X, Gao F, Guo Y. Circ Res. 2025 Jan 16. doi: 10.1161/CIRCRESAHA.124.325611. 10.1161/CIRCRESAHA.124.325611 PubMed 39817340