Skip to main content

pSuperior.retro.neo GFP shScramble
(Plasmid #220357)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220357 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSUPERIOR.retro.neo+gfp
  • Backbone manufacturer
    Oligoengine
  • Backbone size w/o insert (bp) 7385
  • Vector type
    Retroviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shScramble
  • gRNA/shRNA sequence
    GAACCGGATTATACTACAGGT
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGAAGCCTTGGCTTTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also see the second reference: https://doi.org/10.1016/j.celrep.2019.07.031.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSuperior.retro.neo GFP shScramble was a gift from David Kashatus (Addgene plasmid # 220357 ; http://n2t.net/addgene:220357 ; RRID:Addgene_220357)
  • For your References section:

    Proteome-wide copy-number estimation from transcriptomics. Sweatt AJ, Griffiths CD, Groves SM, Paudel BB, Wang L, Kashatus DF, Janes KA. Mol Syst Biol. 2024 Sep 27. doi: 10.1038/s44320-024-00064-3. 10.1038/s44320-024-00064-3 PubMed 39333715