paoB-CBE
(Plasmid
#220373)
-
Purposefor hA3A-nCas9 expression in Aspergillus oryzae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220373 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonehAMA1-argB-AmpR-ori-2 micron-URA3
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehA3A-nCas9
- Promoter Ptef1
Cloning Information
- Cloning method Other
- 5′ sequencing primer catctcctgctaacttctctgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
paoB-CBE was a gift from Xue Gao (Addgene plasmid # 220373 ; http://n2t.net/addgene:220373 ; RRID:Addgene_220373) -
For your References section:
Multiplex Base-Editing Enables Combinatorial Epigenetic Regulation for Genome Mining of Fungal Natural Products. Zhao F, Sun C, Liu Z, Cabrera A, Escobar M, Huang S, Yuan Q, Nie Q, Luo KL, Lin A, Vanegas JA, Zhu T, Hilton IB, Gao X. J Am Chem Soc. 2023 Jan 11;145(1):413-421. doi: 10.1021/jacs.2c10211. Epub 2022 Dec 21. 10.1021/jacs.2c10211 PubMed 36542862