TXN-WT
(Plasmid
#220375)
-
PurposeTXN-promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220375 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneGV238
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTXN
-
SpeciesH. sapiens (human)
-
Entrez GeneTXN (a.k.a. TRDX, TRX, TRX1, TXN1, Trx80)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TTTCTCTATCGATAGGTACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TXN-WT was a gift from Cheng Zhan (Addgene plasmid # 220375)