RT-5
(Plasmid
#220442)
-
PurposeConstruct used to generate the PUF3/PUP2/3HA tagging strains. (aka pBSII/PUF3 5’ flank/PUP2-DADA/3HA/URA3/PUF3 3’ flank)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript II
- Total vector size (bp) 4733
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePUF3
-
Alt namepBSII/PUF3 5’ flank/PUP2-DADA/3HA/URA3/PUF3 3’ flank
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1500
-
GenBank IDNM_065699
-
Entrez Genepuf-3 (a.k.a. CELE_Y45F10A.2)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TGCGGAGGTGACTAGTGGATCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RT-5 was a gift from Marvin Wickens (Addgene plasmid # 220442 ; http://n2t.net/addgene:220442 ; RRID:Addgene_220442) -
For your References section:
Protein-RNA networks revealed through covalent RNA marks. Lapointe CP, Wilinski D, Saunders HA, Wickens M. Nat Methods. 2015 Dec;12(12):1163-70. doi: 10.1038/nmeth.3651. Epub 2015 Nov 2. 10.1038/nmeth.3651 PubMed 26524240