pSliceRep_B_miR-196a
(Plasmid
#220470)
-
PurposeDual luciferase reporter for RNAi, with target site within a tunable ORF (version B)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220470 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBI-CMV1
-
Backbone manufacturerClontech
- Total vector size (bp) 6536
-
Modifications to backboneAdded FLuc and IRES-NanoLuc-PEST degron
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSUMO_Eu1
-
SpeciesSynthetic
-
Insert Size (bp)426
- Promoter Minimal CMV
-
Tag
/ Fusion Protein
- 3xHA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTGACTCACGGGGATTTCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.10.15.562437 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSliceRep_B_miR-196a was a gift from David Bartel (Addgene plasmid # 220470 ; http://n2t.net/addgene:220470 ; RRID:Addgene_220470) -
For your References section:
The guide-RNA sequence dictates the slicing kinetics and conformational dynamics of the Argonaute silencing complex. Wang PY, Bartel DP. Mol Cell. 2024 Jul 10:S1097-2765(24)00533-1. doi: 10.1016/j.molcel.2024.06.026. 10.1016/j.molcel.2024.06.026 PubMed 39025072