pmEos3.1-N1 GBP
(Plasmid
#220492)
-
PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos3.1 to track GFP proteins of interest to perform Fluorescent intrabody Localization Microscopy
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmEos3.1-N1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP Binding Protein tagged with mEos3.1
-
Alt nameGBP, GFP Nanobody, abGFP4
-
Insert Size (bp)1044
-
Tag
/ Fusion Protein
- mEos3.1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bglii (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CMV F' - c gca aat ggg cgg tag gcg tg
- 3′ sequencing primer SV40pA-R - GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmEos3.1-N1 GBP was a gift from Frederic Meunier (Addgene plasmid # 220492 ; http://n2t.net/addgene:220492 ; RRID:Addgene_220492) -
For your References section:
Nanoscale spatiotemporal cluster analysis of expressed and endogenous proteins. Gormal RS, Wallis TP, McCann AJ, Kudo K, Jiang A, Syed P, Longfield SF, Amor R, Meunier FA. Nat Protoc. 2025 Aug 8. doi: 10.1038/s41596-025-01209-w. 10.1038/s41596-025-01209-w PubMed 40781572