Skip to main content

pmEos3.1-N1 GBP
(Plasmid #220492)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220492 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmEos3.1-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP Binding Protein tagged with mEos3.1
  • Alt name
    GBP, GFP Nanobody, abGFP4
  • Insert Size (bp)
    1044
  • Tag / Fusion Protein
    • mEos3.1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bglii (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CMV F' - c gca aat ggg cgg tag gcg tg
  • 3′ sequencing primer SV40pA-R - GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmEos3.1-N1 GBP was a gift from Frederic Meunier (Addgene plasmid # 220492 ; http://n2t.net/addgene:220492 ; RRID:Addgene_220492)
  • For your References section:

    Nanoscale spatiotemporal cluster analysis of expressed and endogenous proteins. Gormal RS, Wallis TP, McCann AJ, Kudo K, Jiang A, Syed P, Longfield SF, Amor R, Meunier FA. Nat Protoc. 2025 Aug 8. doi: 10.1038/s41596-025-01209-w. 10.1038/s41596-025-01209-w PubMed 40781572