Skip to main content

LT3GEPIR-NEK9shRNA1
(Plasmid #220554)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220554 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LT3GEPIR
  • Backbone manufacturer
    Dr. Johannes Zuber
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NEK9 shRNA1
  • gRNA/shRNA sequence
    CCGAGGAATGGAAGGTTTAAT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    125
  • Entrez Gene
    NEK9 (a.k.a. APUG, LCCS10, NC, NERCC, NERCC1)
  • Promoter TRE3G (TetOP) promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGTTTGAATGAGGCTTCAGTAC
  • 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LT3GEPIR-NEK9shRNA1 was a gift from Sean Lee (Addgene plasmid # 220554 ; http://n2t.net/addgene:220554 ; RRID:Addgene_220554)