MigR1 GFP Mouse PHGDH
(Plasmid
#220591)
-
PurposeRetroviral mammalian expression vector with GFP for overexpression of mouse PHGDH
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMigR1 GFP
-
Backbone manufacturerWarren Pear (Addgene plasmid # 27490)
-
Vector typeRetroviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMs PHGDH
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1871
-
Entrez GenePhgdh (a.k.a. 3-PGDH, 3PGDH, 4930479N23, A10, PGAD, PGD, PGDH, SERA)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (unknown if destroyed)
- 3′ cloning site HpaI (unknown if destroyed)
- 5′ sequencing primer GTC GTT AAC CCACC ATGGCCTTCGCAAATCTGCGCAAAG
- 3′ sequencing primer gac gtt aac tca gaa gca gaa ctg gaa agc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MigR1 GFP Mouse PHGDH was a gift from Russell Jones (Addgene plasmid # 220591 ; http://n2t.net/addgene:220591 ; RRID:Addgene_220591)