-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22066 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKT25
- Backbone size (bp) 3468
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- T25-Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTGACCAGCGGCGATTCGGTGACCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NB: Mutation in adenylate cyclase (T186R) - although this does not affect its use.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEB1029 was a gift from Emmanuelle Bouveret (Addgene plasmid # 22066 ; http://n2t.net/addgene:22066 ; RRID:Addgene_22066) -
For your References section:
Improvement of bacterial two-hybrid vectors for detection of fusion proteins and transfer to pBAD-tandem affinity purification, calmodulin binding peptide, or 6-histidine tag vectors. Battesti A, Bouveret E. Proteomics. 2008 Nov . 8(22):4768-71. 10.1002/pmic.200800270 PubMed 18924111