pCM54
(Plasmid
#220830)
-
PurposeEryA sensor with increased sensitivity due to phosphorylation of EryA by mphA, which traps EryA in cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemphA
- Promoter Pmph
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gcaacagtgccggattgaatataacc
- 3′ sequencing primer gaatgagcgaacgtcgatatagcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCM54 was a gift from Matthew Bennett (Addgene plasmid # 220830 ; http://n2t.net/addgene:220830 ; RRID:Addgene_220830) -
For your References section:
Macrolide Biosensor Optimization through Cellular Substrate Sequestration. Miller CA, Ho JM, Parks SE, Bennett MR. ACS Synth Biol. 2021 Feb 19;10(2):258-264. doi: 10.1021/acssynbio.0c00572. Epub 2021 Feb 8. 10.1021/acssynbio.0c00572 PubMed 33555859