Skip to main content

pCM54
(Plasmid #220830)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220830 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mphA
  • Promoter Pmph

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gcaacagtgccggattgaatataacc
  • 3′ sequencing primer gaatgagcgaacgtcgatatagcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCM54 was a gift from Matthew Bennett (Addgene plasmid # 220830 ; http://n2t.net/addgene:220830 ; RRID:Addgene_220830)
  • For your References section:

    Macrolide Biosensor Optimization through Cellular Substrate Sequestration. Miller CA, Ho JM, Parks SE, Bennett MR. ACS Synth Biol. 2021 Feb 19;10(2):258-264. doi: 10.1021/acssynbio.0c00572. Epub 2021 Feb 8. 10.1021/acssynbio.0c00572 PubMed 33555859