1203M-CMV-dDiCas7-11-bGHpolyA
(Plasmid
#220957)
-
PurposeDeactivated DiCas7-11 effector with CMV promoter/enhancer
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDiCas7-11
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctagagatccgcggccgcatgacgactactatgaagatttcaattgaattcctcgagccg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1203M-CMV-dDiCas7-11-bGHpolyA was a gift from Omar Akbari (Addgene plasmid # 220957 ; http://n2t.net/addgene:220957 ; RRID:Addgene_220957)