ORFtag_TetR-SD_Frame1
(Plasmid
#220981)
-
PurposeORFtag viral retroviral vector containing a constitutively active promoter and a TetR tag followed by a splice donor sequence in Frame1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220981 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneORFtag backbone
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetR repressor
-
Alt nameTetR-splice donor in Frame1
- Promoter PGK promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cctggcaatcgagatgctggacag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ORFtag_TetR-SD_Frame1 was a gift from Alexander Stark (Addgene plasmid # 220981 ; http://n2t.net/addgene:220981 ; RRID:Addgene_220981)