pcDNA5-FRT/TO-FLAG-msMMS22L
(Plasmid
#221015)
-
Purposemammalian expression vector of Flag tagged mouse MMS22L
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA5 Flag-FRT-T0
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 5126
- Total vector size (bp) 8843
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMMS22L
-
Alt nameC16orf167
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3714
-
Mutationnaturally siResistant to siMMS22L (human) aagacuugcuguugcgaua
-
Entrez GeneMms22l (a.k.a. F730047E07Rik, Gm134)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT/TO-FLAG-msMMS22L was a gift from Daniel Durocher (Addgene plasmid # 221015 ; http://n2t.net/addgene:221015 ; RRID:Addgene_221015) -
For your References section:
The MMS22L-TONSL complex mediates recovery from replication stress and homologous recombination. O'Donnell L, Panier S, Wildenhain J, Tkach JM, Al-Hakim A, Landry MC, Escribano-Diaz C, Szilard RK, Young JT, Munro M, Canny MD, Kolas NK, Zhang W, Harding SM, Ylanko J, Mendez M, Mullin M, Sun T, Habermann B, Datti A, Bristow RG, Gingras AC, Tyers MD, Brown GW, Durocher D. Mol Cell. 2010 Nov 24;40(4):619-31. doi: 10.1016/j.molcel.2010.10.024. Epub 2010 Nov 4. 10.1016/j.molcel.2010.10.024 PubMed 21055983