H75R SUMO1
(Plasmid
#221060)
-
PurposeExpression of H75R SUMO1 protein under T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 5500
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameH75R site mutation on SUMO 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)327
-
MutationH75R
-
Entrez GeneSUMO1 (a.k.a. DAP1, GMP1, OFC10, PIC1, SENP2, SMT3, SMT3C, SMT3H3, UBL1)
- Promoter T7
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJonggul
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H75R SUMO1 was a gift from Michael Rosen (Addgene plasmid # 221060 ; http://n2t.net/addgene:221060 ; RRID:Addgene_221060) -
For your References section:
Surface Charge Can Modulate Phase Separation of Multidomain Proteins. Kim J, Qin S, Zhou HX, Rosen MK. J Am Chem Soc. 2024 Feb 7;146(5):3383-3395. doi: 10.1021/jacs.3c12789. Epub 2024 Jan 23. 10.1021/jacs.3c12789 PubMed 38262618