Skip to main content

pFSKm4-ATF1
(Plasmid #221133)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221133 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTR47m4
  • Backbone size w/o insert (bp) 3716
  • Total vector size (bp) 5329
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATF1
  • Alt name
    Alcohol acetyltransferase I
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1613
  • Entrez Gene
    ATF1 (a.k.a. YOR377W)
  • Promoter Pm4

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTGTCAAGAGGACATCCGG
  • 3′ sequencing primer GTGAGCCAGTGTGACTCTAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Jaroslaw Bryk and Gregory Stephanopoulos. The ATF1 gene was cloned from p006-Banana-Late (Addgene Plasmid #112251). The backbone was cloned from pTR47m4-GFP (Addgene plasmid #102436)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFSKm4-ATF1 was a gift from André Studart (Addgene plasmid # 221133 ; http://n2t.net/addgene:221133 ; RRID:Addgene_221133)
  • For your References section:

    Living Porous Ceramics for Bacteria-Regulated Gas Sensing and Carbon Capture. Dutto A, Kan A, Saraw Z, Maillard A, Zindel D, Studart AR. Adv Mater. 2024 Dec 10:e2412555. doi: 10.1002/adma.202412555. 10.1002/adma.202412555 PubMed 39659127