Skip to main content

pCB-CRISPRi
(Plasmid #221136)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221136 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJB-KAN-3xFLAG
  • Backbone manufacturer
    Robert Heinzen lab
  • Total vector size (bp) 14077
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3xF-dCas9
  • Species
    Synthetic
  • Promoter cbu1169 promoter
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer TGCTTTACGGTATCGCCGCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

RSF1010-based plasmid. Expresses 3xF-dCas9 from cbu1169 promoter. Unique XhoI, NotI and EcoRI sites for addition of sgRNA-encoding region(s) from pHelper-CRISPRi-sgRNA (Addgene plasmid #221135) helper plasmid derivatives. Plasmid alias: pSAST200.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB-CRISPRi was a gift from Craig Roy (Addgene plasmid # 221136 ; http://n2t.net/addgene:221136 ; RRID:Addgene_221136)
  • For your References section:

    CRISPR-Cas9-based approaches for genetic analysis and epistatic interaction studies in Coxiella burnetii. Steiner S, Roy CR. mSphere. 2024 Nov 19:e0052324. doi: 10.1128/msphere.00523-24. 10.1128/msphere.00523-24 PubMed 39560384