pQFmcs-2H12.D11
(Plasmid
#221183)
-
PurposecdGreen2 expressed from a cumate-inducible promoter (Internal Lab ID: UJ11216)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQFmcs
-
Backbone manufacturerAndreas Kaczmarczyk
- Backbone size w/o insert (bp) 7300
- Total vector size (bp) 8600
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecdGreen2
-
Alt name2H12.D11
-
SpeciesSynthetic
-
Insert Size (bp)1300
- Promoter PQ5 (cumate-inducible)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer 10572 (TACATATGTCAATGTACCGG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A I9S mutation in TetR was found in the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQFmcs-2H12.D11 was a gift from Urs Jenal (Addgene plasmid # 221183 ; http://n2t.net/addgene:221183 ; RRID:Addgene_221183) -
For your References section:
A genetically encoded biosensor to monitor dynamic changes of c-di-GMP with high temporal resolution. Kaczmarczyk A, van Vliet S, Jakob RP, Teixeira RD, Scheidat I, Reinders A, Klotz A, Maier T, Jenal U. Nat Commun. 2024 May 9;15(1):3920. doi: 10.1038/s41467-024-48295-0. 10.1038/s41467-024-48295-0 PubMed 38724508