pQFmcs-2H12.D11-scarREF
(Plasmid
#221184)
-
PurposecdGreen2 expressed from a cumate-inducible promoter in an operon with mScarlet-I (downstream) as a reference FP (Internal Lab ID: UJ11240)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQFmcs
-
Backbone manufacturerAndreas Kaczmarczyk
- Backbone size w/o insert (bp) 7300
- Total vector size (bp) 9300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namecdGreen2
-
Alt name2H12.D11
-
SpeciesSynthetic
-
Insert Size (bp)1300
- Promoter PQ5 (cumate-inducible)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer 10572 (TACATATGTCAATGTACCGG) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemScarlet-I
-
SpeciesSynthetic
-
Insert Size (bp)700
-
MutationN-terminus changed: starts with MSKKYGEAVIKE ...
- Promoter None (same as cdGreen2)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NheI/SpeI (destroyed during cloning)
- 5′ sequencing primer NA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQFmcs-2H12.D11-scarREF was a gift from Urs Jenal (Addgene plasmid # 221184 ; http://n2t.net/addgene:221184 ; RRID:Addgene_221184) -
For your References section:
A genetically encoded biosensor to monitor dynamic changes of c-di-GMP with high temporal resolution. Kaczmarczyk A, van Vliet S, Jakob RP, Teixeira RD, Scheidat I, Reinders A, Klotz A, Maier T, Jenal U. Nat Commun. 2024 May 9;15(1):3920. doi: 10.1038/s41467-024-48295-0. 10.1038/s41467-024-48295-0 PubMed 38724508