pTE5417_p3WJdB_promoter dropout vector
(Plasmid
#221191)
-
Purpose(Empty Backbone) Promoter probe vector with dropout sequence for promoter sequences with 3WJdB reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAmp/ColE1
- Backbone size (bp) 2109
-
Modifications to backboneadded a 3WJdB reporter with T7 terminator under the control of a promoter placeholder/dropout site (see Marburg Collection)
-
Vector typeSynthetic Biology
- Promoter Promoter Placeholder/Dropout Vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CGGTTCCTGGCCTTTTGC
- 3′ sequencing primer GATAGGTGCCTCACTGATTAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For details on placeholder/dropout sequences see Stukenberg et al.: https://doi.org/10.1021/acssynbio.1c00126.
Please visit https://doi.org/10.1101/2024.04.26.591264 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE5417_p3WJdB_promoter dropout vector was a gift from Tobias Erb (Addgene plasmid # 221191 ; http://n2t.net/addgene:221191 ; RRID:Addgene_221191) -
For your References section:
In vitro transcription-based biosensing of glycolate for prototyping of a complex enzyme cascade. Barthel S, Brenker L, Diehl C, Bohra N, Giaveri S, Paczia N, Erb TJ. Synth Biol (Oxf). 2024 Sep 20;9(1):ysae013. doi: 10.1093/synbio/ysae013. eCollection 2024. 10.1093/synbio/ysae013 PubMed 39399720