pcDNA5-FRT/T0-3xFLAG-NFATC2IP ∆SLD1
(Plasmid
#221209)
-
PurposeMammalian expression vector of triple Flag tagged NFATC2IP ORF with SUMO-like domain 1 (SLD1, aa 256-344) deleted
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA5-3X-Flag-FRT-T0
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 5191
- Total vector size (bp) 6181
-
Modifications to backbone1xFLAG was replaced by HindIII-3xFLAG-AscI, yielding 3xFLAG vector for N-terminal tagging with MCS
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNFATC2IP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)990
-
MutationSUMO-like domain 1 (SLD1, aa 256-344) deleted, 1st Methionine of NFATC2IP deleted
-
Entrez GeneNFATC2IP (a.k.a. ESC2, NIP45, RAD60)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3XFlag (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT/T0-3xFLAG-NFATC2IP ∆SLD1 was a gift from Daniel Durocher (Addgene plasmid # 221209 ; http://n2t.net/addgene:221209 ; RRID:Addgene_221209) -
For your References section:
NFATC2IP is a mediator of SUMO-dependent genome integrity. Cho T, Hoeg L, Setiaputra D, Durocher D. Genes Dev. 2024 Apr 17;38(5-6):233-252. doi: 10.1101/gad.350914.123. 10.1101/gad.350914.123 PubMed 38503515