mC4-GFP
(Plasmid
#221339)
-
PurposeExpresses murine homolog of complement 4 fused with GFP under CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4895
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemurine C4 fused with GFP
-
Alt nameC4-GFP, mC4-GFP, C4b-GFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6056
-
Entrez GeneC4b (a.k.a. C4, Ss)
- Promoter CAG
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer ggctctagagcctctgctaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.09.09.556388 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mC4-GFP was a gift from Alberto Cruz-Martín (Addgene plasmid # 221339 ; http://n2t.net/addgene:221339 ; RRID:Addgene_221339) -
For your References section:
The schizophrenia risk gene C4 induces pathological synaptic loss by impairing AMPAR trafficking. Phadke RA, Brack A, Fournier LA, Kruzich E, Sha M, Picard I, Johnson C, Stroumbakis D, Salgado M, Yeung C, Escude Velasco B, Liu YY, Cruz-Martin A. Mol Psychiatry. 2025 Feb;30(2):796-809. doi: 10.1038/s41380-024-02701-7. Epub 2024 Sep 3. 10.1038/s41380-024-02701-7 PubMed 39227431