pGex-6p2_ATRX
(Plasmid
#221377)
-
PurposeExpresses ATRX in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGex-6p2
- Backbone size w/o insert (bp) 4945
- Total vector size (bp) 5854
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTranscriptional regulator ATRX
-
Alt nameATRX
-
SpeciesH. sapiens (human)
-
Insert Size (bp)909
-
Entrez GeneATRX (a.k.a. JMS, MRX52, RAD54, RAD54L, XH2, XNP, ZNF-HX)
- Promoter tac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGex-6p2_ATRX was a gift from Albert Jeltsch (Addgene plasmid # 221377 ; http://n2t.net/addgene:221377 ; RRID:Addgene_221377) -
For your References section:
Discovery of NSD2 non-histone substrates and design of a super-substrate. Weirich S, Kusevic D, Schnee P, Reiter J, Pleiss J, Jeltsch A. Commun Biol. 2024 Jun 8;7(1):707. doi: 10.1038/s42003-024-06395-z. 10.1038/s42003-024-06395-z PubMed 38851815