pEYFP_C1_ATRX
(Plasmid
#221383)
-
PurposeExpresses ATRX in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221383 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEYFP-C1
- Backbone size w/o insert (bp) 4713
- Total vector size (bp) 5622
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTranscriptional regulator ATRX
-
Alt nameATRX
-
SpeciesH. sapiens (human)
-
Insert Size (bp)909
-
MutationK536N (Please see depositor comments)
-
Entrez GeneATRX (a.k.a. JMS, MRX52, RAD54, RAD54L, XH2, XNP, ZNF-HX)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACATGGTCCTGCTGGAGTTCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The K536N mutation in the insert is not of relevance to the experiments conducted in the publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEYFP_C1_ATRX was a gift from Albert Jeltsch (Addgene plasmid # 221383 ; http://n2t.net/addgene:221383 ; RRID:Addgene_221383) -
For your References section:
Discovery of NSD2 non-histone substrates and design of a super-substrate. Weirich S, Kusevic D, Schnee P, Reiter J, Pleiss J, Jeltsch A. Commun Biol. 2024 Jun 8;7(1):707. doi: 10.1038/s42003-024-06395-z. 10.1038/s42003-024-06395-z PubMed 38851815