Skip to main content

pBB328
(Plasmid #221533)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221533 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBB298 (parent plasmid pEB001)
  • Modifications to backbone
    Minor modification through site-selective mutagenesis to pEB001 plasmid, which is a derivative of the pMiniHimar plasmid. Brutinel ED, Gralnick JA. 2012. Anomalies of the anaerobic tricarboxylic acid cycle in Shewanella oneidensis revealed by Tn-seq. Mol Microbiol 86:273–283.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Escherichia coli BW25141 (for cloning)
  • Growth instructions
    Use WM3064 for conjugation
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    vioABCE
  • Alt name
    violacein operon segment from BBa_J72214-BBa_J72090
  • Species
    Synthetic
  • Promoter None, contains RBS site

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI/BglII (destroyed during cloning)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GCTATCGTGACCTTGATAACGGCTGAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Mariner transposase and transposon backbone from pBB298 (originally from pEB001)

Gene/Insert 3

  • Gene/Insert name
    Tetracycline antibiotic cassette from pRK415

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    violacein cassette comes from addgene BBa_J72214-BBa_J72090, transposase and backbone is from pEB001.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBB328 was a gift from Brett Barney (Addgene plasmid # 221533 ; http://n2t.net/addgene:221533 ; RRID:Addgene_221533)