pPB-EF1A-Puro-mCherry-RAB7
(Plasmid
#221555)
-
PurposeExpresse Cherry-tagged human Rab7 in mammalian cells. Compatible with piggybac transposase for genome integration.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPB
-
Backbone manufacturerVectorbuilder
-
Vector typeMammalian Expression ; piggybac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab7A
-
Alt nameRab7
-
SpeciesH. sapiens (human)
-
Entrez GeneRAB7A (a.k.a. CMT2B, PRO2706, RAB7)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymCherry-Rab7 sequence was amplified from Addgene plasmid #61804 and inserted into Addgene plasmid #221553 such that the mCherry-Rab7 from plasmid #61804 replaced the TBK1-GFP from plasmid 221553
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.12.16.571979 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-EF1A-Puro-mCherry-RAB7 was a gift from Shawn Ferguson (Addgene plasmid # 221555 ; http://n2t.net/addgene:221555 ; RRID:Addgene_221555) -
For your References section:
Lysosomal TBK1 responds to amino acid availability to relieve Rab7-dependent mTORC1 inhibition. Talaia G, Bentley-DeSousa A, Ferguson SM. EMBO J. 2024 Sep;43(18):3948-3967. doi: 10.1038/s44318-024-00180-8. Epub 2024 Aug 5. 10.1038/s44318-024-00180-8 PubMed 39103493