POC1431
(Plasmid
#221578)
-
PurposeAssembled plasmid containing four inserts (from POC1426, POC1427, POC1428 and POC1429) assembled using the site-selective methylation protection approach
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePOC1430
-
Backbone manufacturerSelf-made
- Backbone size w/o insert (bp) 4391
- Total vector size (bp) 7998
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAssembled construct flanked by methylation-protectable BsaI sites and containing four always-methylable internal BsaI sites
-
Alt nameMICA gene fragment
-
Insert Size (bp)3607
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (unknown if destroyed)
- 3′ cloning site BsaI (unknown if destroyed)
- 5′ sequencing primer TGGTGTAAACAAATTGACGC
- 3′ sequencing primer ACGCCCTTTTAAATATCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The DH10B strain should be used for expression of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
POC1431 was a gift from Christopher A. O'Callaghan (Addgene plasmid # 221578 ; http://n2t.net/addgene:221578 ; RRID:Addgene_221578) -
For your References section:
UniClo: scarless hierarchical DNA assembly without sequence constraint. Flores-Fernandez CN, Lin D, Robins K, O'Callaghan CA. Nucleic Acids Res. 2025 Jun 20;53(12):gkaf548. doi: 10.1093/nar/gkaf548. 10.1093/nar/gkaf548 PubMed 40548934