Skip to main content
Addgene

POC1431
(Plasmid #221578)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221578 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    POC1430
  • Backbone manufacturer
    Self-made
  • Backbone size w/o insert (bp) 4391
  • Total vector size (bp) 7998
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Assembled construct flanked by methylation-protectable BsaI sites and containing four always-methylable internal BsaI sites
  • Alt name
    MICA gene fragment
  • Insert Size (bp)
    3607

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (unknown if destroyed)
  • 3′ cloning site BsaI (unknown if destroyed)
  • 5′ sequencing primer TGGTGTAAACAAATTGACGC
  • 3′ sequencing primer ACGCCCTTTTAAATATCCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The DH10B strain should be used for expression of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    POC1431 was a gift from Christopher A. O'Callaghan (Addgene plasmid # 221578 ; http://n2t.net/addgene:221578 ; RRID:Addgene_221578)
  • For your References section:

    UniClo: scarless hierarchical DNA assembly without sequence constraint. Flores-Fernandez CN, Lin D, Robins K, O'Callaghan CA. Nucleic Acids Res. 2025 Jun 20;53(12):gkaf548. doi: 10.1093/nar/gkaf548. 10.1093/nar/gkaf548 PubMed 40548934