p8391 LentiCRISPRv2 Neo sgPTPN14-1
(Plasmid
#221651)
-
PurposeExpression of sgRNA targeting the locus of human PTPN14
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLentiCRISPR v2
-
Backbone manufacturerFeng Zhang (Addgene #52961)
-
Vector typeLentiviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgPTPN14-1
-
gRNA/shRNA sequenceCATGACTGTCTCATAATCGG
-
SpeciesH. sapiens (human)
-
Entrez GenePTPN14 (a.k.a. CATLPH, PEZ, PTP36, PTPD2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.03.07.583953 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p8391 LentiCRISPRv2 Neo sgPTPN14-1 was a gift from Elizabeth White (Addgene plasmid # 221651 ; http://n2t.net/addgene:221651 ; RRID:Addgene_221651) -
For your References section:
HPV18 E7 inhibits LATS1 kinase and activates YAP1 by degrading PTPN14. Blakely WJ, Hatterschide J, White EA. mBio. 2024 Sep 9:e0181124. doi: 10.1128/mbio.01811-24. 10.1128/mbio.01811-24 PubMed 39248565