Skip to main content

pX330 - LRR1 Terminal CRISPR
(Plasmid #221705)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221705 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 8500
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TGTAGCTTCATCTCGCCCAA
  • Alt name
    LRR1 N-terminal gRNA sequence
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter Chicken Beta-actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330 - LRR1 Terminal CRISPR was a gift from Aga Gambus (Addgene plasmid # 221705 ; http://n2t.net/addgene:221705 ; RRID:Addgene_221705)
  • For your References section:

    Characterizing replisome disassembly in human cells. Jones RM, Ruiz JH, Scaramuzza S, Nath S, Liu C, Henklewska M, Natsume T, Bristow RG, Romero F, Kanemaki MT, Gambus A. iScience. 2024 Jun 12;27(7):110260. doi: 10.1016/j.isci.2024.110260. eCollection 2024 Jul 19. 10.1016/j.isci.2024.110260 PubMed 39055910