pX330 - LRR1 Terminal CRISPR
(Plasmid
#221705)
-
PurposeCas9 targeting plasmid with gRNA specific for LRR1 N-terminus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221705 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 8500
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTGTAGCTTCATCTCGCCCAA
-
Alt nameLRR1 N-terminal gRNA sequence
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter Chicken Beta-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330 - LRR1 Terminal CRISPR was a gift from Aga Gambus (Addgene plasmid # 221705 ; http://n2t.net/addgene:221705 ; RRID:Addgene_221705) -
For your References section:
Characterizing replisome disassembly in human cells. Jones RM, Ruiz JH, Scaramuzza S, Nath S, Liu C, Henklewska M, Natsume T, Bristow RG, Romero F, Kanemaki MT, Gambus A. iScience. 2024 Jun 12;27(7):110260. doi: 10.1016/j.isci.2024.110260. eCollection 2024 Jul 19. 10.1016/j.isci.2024.110260 PubMed 39055910