Skip to main content
Addgene

pdU6-2_sgRNA-d5-HT1AR
(Plasmid #221820)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221820 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pU6b
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    d5-HT1AR gRNA
  • gRNA/shRNA sequence
    gaccagtccactaccgcagc
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    5-HT1A (a.k.a. Dmel_CG16720, 5-HT-dro2A, 5-HT1ADro, 5-HT[1A]Dro, 5-HT[[1ADro]], 5-HT[[1A]], 5-HT[[1A]]DRO, 5HT-R2A, 5HT-dro2A, 5HT-drp[[2A]], 5HT1A, 5HT[[1ADro]], 5htdro2a, CG16720, DRO2A, Dm5HTdro2A, Dmel\CG16720, d5-HT1A)
  • Promoter zebrafish U6 promoter (U6b)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.04.14.589413 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdU6-2_sgRNA-d5-HT1AR was a gift from Quentin Gaudry (Addgene plasmid # 221820)
  • For your References section:

    Serotonin acts through multiple cellular targets during an olfactory critical period. Mallick A, Tan HL, Epstein JM, Gaudry Q, Dacks AM. bioRxiv [Preprint]. 2024 Apr 14:2024.04.14.589413. doi: 10.1101/2024.04.14.589413. 10.1101/2024.04.14.589413 PubMed 38645269