pdU6-2_sgRNA2-for-dSERT
(Plasmid
#221831)
-
PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frame
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepdU6-2
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedSERT gRNA2
-
gRNA/shRNA sequencegggattcgagcggcccgtcg
-
SpeciesD. melanogaster (fly)
-
Entrez GeneSerT (a.k.a. Dmel_CG4545, CG4545, DmSERT, DmSerT, Dmel\CG4545, SERT, Sert, dSERT, dSERT1, dSerT, dSert, dmSERT, dsert, serT)
- Promoter Drosophila U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site N/A (unknown if destroyed)
- 5′ sequencing primer N/A (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.04.14.589413 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdU6-2_sgRNA2-for-dSERT was a gift from Quentin Gaudry (Addgene plasmid # 221831 ; http://n2t.net/addgene:221831 ; RRID:Addgene_221831) -
For your References section:
Serotonin acts through multiple cellular targets during an olfactory critical period. Mallick A, Tan HL, Epstein JM, Gaudry Q, Dacks AM. bioRxiv [Preprint]. 2024 Apr 14:2024.04.14.589413. doi: 10.1101/2024.04.14.589413. 10.1101/2024.04.14.589413 PubMed 38645269