Skip to main content

Tol2-U6.3-sgRNA-non-targeting-control -GFP
(Plasmid #221844)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221844 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTol2{Exp}
  • Backbone manufacturer
    vectorbuilder
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 5672
  • Modifications to backbone
    Chick U6.3 RNA promotor to express sgRNA and EGFP expressed from GACG promoter
  • Vector type
    Mammalian Expression, CRISPR ; Tol2 transposon optimised for chick expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    717
  • Promoter GACG

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    non-targeting control sgRNA- GCACTGCTACGATCTACACC
  • Promoter U6.3 chick

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer -
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.03.04.583298 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-U6.3-sgRNA-non-targeting-control -GFP was a gift from Stephen Terry (Addgene plasmid # 221844 ; http://n2t.net/addgene:221844 ; RRID:Addgene_221844)
  • For your References section:

    Mitochondrial dynamics regulate cell morphology in the developing cochlea. O'Sullivan JDB, Terry S, Scott CA, Bullen A, Jagger DJ, Mann ZF. Development. 2024 Aug 1;151(15):dev202845. doi: 10.1242/dev.202845. Epub 2024 Aug 9. 10.1242/dev.202845 PubMed 39120083